Accession | MI0005044 | ||||
Name | bta-mir-29c | ||||
similar to following miRCarta precursors | bta-51.1 | ||||
Organism | Bos taurus | ||||
Genome | UMD3.1 | ||||
Location |
chr16:77,478,593-77,478,680 (+) |
||||
miRNA | bta-miR-29c | ||||
Sequence (5' -> 3') (88 nts) |
AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGA | ||||
MFE | -34.80 kcal/mol | ||||
first miRBase version | 8.2 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
bta-mir-29b-2
bta-mir-29c |
||||
Family | mir-29 (MIPF0000009) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
2 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |