Accession | MI0005043 | ||||||||
Name | bta-mir-29b-2 | ||||||||
similar to following miRCarta precursors | bta-81.1 | ||||||||
Organism | Bos taurus | ||||||||
Genome | UMD3.1 | ||||||||
Location |
chr16:77,478,033-77,478,113 (+) |
||||||||
miRNA | bta-miR-29b | ||||||||
Sequence (5' -> 3') (81 nts) |
CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG | ||||||||
MFE | -31.10 kcal/mol | ||||||||
first miRBase version | 8.2 | ||||||||
last miRBase version | 21.0 | ||||||||
Clusters (10 kb) (2 precursors) |
bta-mir-29b-2 bta-mir-29c |
||||||||
Family | mir-29 (MIPF0000009) | ||||||||
Experiments |
|
||||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
2 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |