Accession | MI0005041 | ||||
Name | bta-mir-22 | ||||
similar to following miRCarta precursors | bta-217-2.1 | ||||
Organism | Bos taurus | ||||
Genome | UMD3.1 | ||||
Location |
chr19:23,382,435-23,382,519 (-) |
||||
miRNA | bta-miR-22-5p | ||||
miRNA | bta-miR-22-3p | ||||
Sequence (5' -> 3') (85 nts) |
GGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUGACCCAGCUAAAGCUGCCAGUUGAAGAACUGUUGCCCUCUGCC | ||||
MFE | -39.80 kcal/mol | ||||
first miRBase version | 8.2 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
bta-mir-22 bta-mir-3600 |
||||
Family | mir-22 (MIPF0000053) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
2 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |
3 | Long et al. | Biochem. Genet. | 2009 | 19267191 | Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning. |