| Accession | MI0005032 | ||||||||
| Name | bta-mir-181c | ||||||||
| similar to following miRCarta precursors | bta-165.1 | ||||||||
| Organism | Bos taurus | ||||||||
| Genome | UMD3.1 | ||||||||
| Location |
chr7:12,915,072-12,915,168 (+) |
||||||||
| miRNA | bta-miR-181c | ||||||||
| Sequence (5' -> 3') (97 nts) |
UUGCCAAGGGUUUGGGGGAACAUUCAACCUGUCGGUGAGUUUGGGCAGCUCAGGCAAACCAUCGACCGUUGAGUGGACCCCGAGGCCUGGAACUGCC | ||||||||
| MFE | -45.30 kcal/mol | ||||||||
| first miRBase version | 8.2 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (2 precursors) |
bta-mir-181c bta-mir-181d |
||||||||
| Family | mir-181 (MIPF0000007) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |