| Accession | MI0005031 | ||||
| Name | bta-mir-17 | ||||
| similar to following miRCarta precursors | bta-88-113.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr12:66,226,554-66,226,637 (+) |
||||
| miRNA | bta-miR-17-5p | ||||
| miRNA | bta-miR-17-3p | ||||
| Sequence (5' -> 3') (84 nts) |
GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC | ||||
| MFE | -33.80 kcal/mol | ||||
| first miRBase version | 8.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
bta-mir-17 bta-mir-18a bta-mir-19a bta-mir-20a bta-mir-19b bta-mir-92a-1 |
||||
| Family | mir-17 (MIPF0000001) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |