| Accession | MI0005027 | ||||||||
| Name | bta-mir-124a-1 | ||||||||
| similar to following miRCarta precursors | bta-837.1 | ||||||||
| Organism | Bos taurus | ||||||||
| Genome | UMD3.1 | ||||||||
| Location |
chr8:9,153,380-9,153,464 (+) |
||||||||
| miRNA | bta-miR-124a | ||||||||
| Sequence (5' -> 3') (85 nts) |
AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG | ||||||||
| MFE | -35.30 kcal/mol | ||||||||
| first miRBase version | 8.2 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (1 precursors) |
bta-mir-124a-1 |
||||||||
| Family | mir-124 (MIPF0000021) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |
| 3 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |