| Accession | MI0005021 | ||||
| Name | bta-mir-380 | ||||
| similar to following miRCarta precursors | bta-27882-27881.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr21:67,564,803-67,564,863 (+) |
||||
| miRNA | bta-miR-380-5p | ||||
| miRNA | bta-miR-380-3p | ||||
| Sequence (5' -> 3') (61 nts) |
AAGAUGGUUGACCAUAGAACAUGCGCUGUCUCUAUGUCGUAUGUAAUGUGGUCCACGUCUU | ||||
| MFE | -22.80 kcal/mol | ||||
| first miRBase version | 8.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (14 precursors) |
bta-mir-379
bta-mir-411a bta-mir-299 bta-mir-380 bta-mir-411b bta-mir-1197 bta-mir-323 bta-mir-758 bta-mir-329b bta-mir-329a bta-mir-494 bta-mir-1193 bta-mir-543 bta-mir-495 |
||||
| Family | mir-379 (MIPF0000126) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |