| Accession | MI0004994 | ||||
| Name | gga-mir-21 | ||||
| similar to following miRCarta precursors | gga-25101-26786.1 | ||||
| Organism | Gallus gallus | ||||
| Genome | Gallus-gallus-4.0 | ||||
| Location |
chr19:7,367,265-7,367,361 (+) |
||||
| miRNA | gga-miR-21-5p | ||||
| miRNA | gga-miR-21-3p | ||||
| Sequence (5' -> 3') (97 nts) |
UGUACCAUCCUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGGAUCUCAUGGCAACAACAGUCGGUAGGCUGUCUGACAUUUUGGUAUCUCUCA | ||||
| MFE | -45.80 kcal/mol | ||||
| first miRBase version | 8.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
gga-mir-21 |
||||
| Family | mir-21 (MIPF0000060) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xu et al. | FEBS Lett. | 2006 | 16750530 | Identification of microRNAs from different tissues of chicken embryo and adult chicken. |
| 2 | Yao et al. | J. Virol. | 2008 | 18256158 | MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |