Accession | MI0004994 | ||||
Name | gga-mir-21 | ||||
similar to following miRCarta precursors | gga-25101-26786.1 | ||||
Organism | Gallus gallus | ||||
Genome | Gallus-gallus-4.0 | ||||
Location |
chr19:7,367,265-7,367,361 (+) |
||||
miRNA | gga-miR-21-5p | ||||
miRNA | gga-miR-21-3p | ||||
Sequence (5' -> 3') (97 nts) |
UGUACCAUCCUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGGAUCUCAUGGCAACAACAGUCGGUAGGCUGUCUGACAUUUUGGUAUCUCUCA | ||||
MFE | -45.80 kcal/mol | ||||
first miRBase version | 8.2 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
gga-mir-21 |
||||
Family | mir-21 (MIPF0000060) | ||||
Experiments |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Xu et al. | FEBS Lett. | 2006 | 16750530 | Identification of microRNAs from different tissues of chicken embryo and adult chicken. |
2 | Yao et al. | J. Virol. | 2008 | 18256158 | MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs. |
3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |