| Accession | MI0005062 | ||||
| Name | bta-let-7f-1 | ||||
| similar to following miRCarta precursors | bta-20.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr8:86,885,225-86,885,311 (+) |
||||
| miRNA | bta-let-7f | ||||
| Sequence (5' -> 3') (87 nts) |
UCAGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUUUUACCCUGUUCAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGA | ||||
| MFE | -40.70 kcal/mol | ||||
| first miRBase version | 8.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
bta-let-7a-1
bta-let-7f-1 bta-let-7d |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |
| 2 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 3 | Long et al. | Biochem. Genet. | 2009 | 19267191 | Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning. |