| Accession | MI0004893 | ||||
| Name | xtr-mir-18a | ||||
| similar to following miRCarta precursors | xtr-262-389.1 | ||||
| Organism | Xenopus tropicalis | ||||
| Genome | JGI 4.2 | ||||
| Location |
GL173376.1:85,669-85,755 (-) |
||||
| miRNA | xtr-miR-18a-5p | ||||
| miRNA | xtr-miR-18a-3p | ||||
| Sequence (5' -> 3') (87 nts) |
GUGCUUUUUGUCCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAAAAGU | ||||
| MFE | -28.80 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
xtr-mir-92a-1
xtr-mir-19b-2 xtr-mir-20a xtr-mir-19a xtr-mir-18a xtr-mir-17 |
||||
| Family | mir-17 (MIPF0000001) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Tang et al. | Genome Res. | 2008 | 18032731 | Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation. |