| Accession | MI0004855 | ||||
| Name | xtr-mir-192 | ||||
| similar to following miRCarta precursors | xtr-38025.1 | ||||
| Organism | Xenopus tropicalis | ||||
| Genome | JGI 4.2 | ||||
| Location |
GL172932.1:1,453,300-1,453,386 (+) |
||||
| miRNA | xtr-miR-192 | ||||
| Sequence (5' -> 3') (87 nts) |
GAGUGUACGGGCCUAUGACCUAUGAAUUGACAGCCAGUGGAUGUGAAGUCUGCCUGUCAAUUCUGUAGGCCACAGGUUCGUCCACCU | ||||
| MFE | -40.30 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
xtr-mir-194-2
xtr-mir-192 |
||||
| Family | mir-192 (MIPF0000063) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Tang et al. | Genome Res. | 2008 | 18032731 | Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation. |