| Accession | MI0004802 | ||||
| Name | xtr-mir-16a | ||||
| similar to following miRCarta precursors | xtr-27686.1 | ||||
| Organism | Xenopus tropicalis | ||||
| Genome | JGI 4.2 | ||||
| Location |
GL172803.1:1,671,283-1,671,364 (-) |
||||
| miRNA | xtr-miR-16a | ||||
| Sequence (5' -> 3') (82 nts) |
GCCAGCAGUCCUUUAGCAGCACGUAAAUAUUGGUGUUAAAAUGGUCCCAAUAUUAACUGUGCUGCUAGAGUAAGGUUGGCCU | ||||
| MFE | -37.70 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
xtr-mir-16a xtr-mir-15a |
||||
| Family | mir-15 (MIPF0000006) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Tang et al. | Genome Res. | 2008 | 18032731 | Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation. |