| Accession | MI0004792 | ||||
| Name | xtr-mir-7-2 | ||||
| similar to following miRCarta precursors | xtr-26088.1 | ||||
| Organism | Xenopus tropicalis | ||||
| Genome | JGI 4.2 | ||||
| Location |
GL172658.1:1,242,937-1,243,039 (+) |
||||
| miRNA | xtr-miR-7 | ||||
| Sequence (5' -> 3') (103 nts) |
GAGGUGCAGGCUGACUCUUUGUGGAAGACUAGUGAUUUUGUUGUUGUAAGCCUUAUUGCAUGACAACAAGUCACAGUCUGCCUCACAGUGCCCAGCAAUAUCA | ||||
| MFE | -33.60 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
xtr-mir-7-2 |
||||
| Family | mir-7 (MIPF0000022) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Tang et al. | Genome Res. | 2008 | 18032731 | Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation. |