Accession | MI0004750 | ||||
Name | bta-mir-499 | ||||
similar to following miRCarta precursors | bta-687.1 | ||||
Organism | Bos taurus | ||||
Genome | UMD3.1 | ||||
Location |
chr13:64,900,480-64,900,582 (+) |
||||
miRNA | bta-miR-499 | ||||
Sequence (5' -> 3') (103 nts) |
GGGCGGGCGGCCGUUAAGACUUGCAGUGAUGUUUAACUCCUCUCCACGUGAACAUCACAGCAAGUCUGUGCUGCUUCCCGUCCCCACGCUGCCUGGGCAGGGU | ||||
MFE | -52.00 kcal/mol | ||||
first miRBase version | 8.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
bta-mir-499 |
||||
Family | mir-499 (MIPF0000173) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |