| Accession | MI0004746 | ||||
| Name | bta-mir-27a | ||||
| similar to following miRCarta precursors | bta-27588-43.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr7:12,981,791-12,981,868 (-) |
||||
| miRNA | bta-miR-27a-5p | ||||
| miRNA | bta-miR-27a-3p | ||||
| Sequence (5' -> 3') (78 nts) |
UGGCCUGGGGAGCAGGGCUUAGCUGCUUGUGAGCAGGUCCACAUCAAAUCGUGUUCACAGUGGCUAAGUUCCGCCCCC | ||||
| MFE | -38.20 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
bta-mir-24-2
bta-mir-27a bta-mir-23a |
||||
| Family | mir-27 (MIPF0000036) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Glazov et al. | PLoS ONE | 2009 | 19633723 | Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection. |