| Accession | MI0004733 | ||||
| Name | bta-mir-29a | ||||
| similar to following miRCarta precursors | bta-27521.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr4:95,402,319-95,402,382 (-) |
||||
| miRNA | bta-miR-29a | ||||
| Sequence (5' -> 3') (64 nts) |
AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAU | ||||
| MFE | -24.60 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
bta-mir-29a bta-mir-29b-1 |
||||
| Family | mir-29 (MIPF0000009) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |