| Accession | MI0004703 | ||||||||
| Name | mmu-mir-501 | ||||||||
| similar to following miRCarta precursors | mmu-25621-25620.1 | ||||||||
| Organism | Mus musculus | ||||||||
| Genome | GRCm38.p5 | ||||||||
| Location |
chrX:7,241,243-7,241,351 (-) |
||||||||
| miRNA | mmu-miR-501-5p | ||||||||
| miRNA | mmu-miR-501-3p | ||||||||
| Sequence (5' -> 3') (109 nts) |
CUUCUGCUCUGCUCAUCCUCUCUAAUCCUUUGUCCCUGGGUGAAAAUGCUAUUUGUAUGCAAUGCACCCGGGCAAGGAUUUGGGGAAGGUGAGCCUGAUCUGCAUGGAG | ||||||||
| MFE | -46.90 kcal/mol | ||||||||
| first miRBase version | 8.1 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (5 precursors) |
mmu-mir-500
mmu-mir-501 mmu-mir-362 mmu-mir-188 mmu-mir-532 |
||||||||
| Family | mir-500 (MIPF0000139) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |