| Accession | MI0004702 | ||||||
| Name | mmu-mir-500 | ||||||
| similar to following miRCarta precursors | mmu-25619-25618.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chrX:7,237,683-7,237,774 (-) |
||||||
| miRNA | mmu-miR-500-5p | ||||||
| miRNA | mmu-miR-500-3p | ||||||
| Sequence (5' -> 3') (92 nts) |
CUCCUCUGCUCCCCCUCUCUAAUCCUUGCUAUCUGGGUGCUUAGUGCUAUCUCAAUGCAAUGCACCUGGGCAAGGGUUCAGAGAAGGUGAGC | ||||||
| MFE | -41.90 kcal/mol | ||||||
| first miRBase version | 8.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (3 precursors) |
mmu-mir-500 mmu-mir-501 mmu-mir-362 |
||||||
| Family | mir-500 (MIPF0000139) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wheeler et al. | FEBS Lett. | 2006 | 16566924 | Identification of new central nervous system specific mouse microRNAs. |
| 2 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 6 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |