| Accession | MI0004679 | ||||||||||
| Name | mmu-mir-455 | ||||||||||
| similar to following miRCarta precursors | mmu-24474-24473.1 | ||||||||||
| Organism | Mus musculus | ||||||||||
| Genome | GRCm38.p5 | ||||||||||
| Location |
chr4:63,256,851-63,256,932 (+) |
||||||||||
| miRNA | mmu-miR-455-5p | ||||||||||
| miRNA | mmu-miR-455-3p | ||||||||||
| Sequence (5' -> 3') (82 nts) |
CUCCCUGGUGUGAGCGUAUGUGCCUUUGGACUACAUCGUGAACGCAGCACCAUGCAGUCCACGGGCAUAUACACUUGCCUCA | ||||||||||
| MFE | -36.50 kcal/mol | ||||||||||
| first miRBase version | 8.1 | ||||||||||
| last miRBase version | 21.0 | ||||||||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-455 |
||||||||||
| Family | mir-455 (MIPF0000129) | ||||||||||
| Experiments |
|
||||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Takada et al. | Nucleic Acids Res. | 2006 | 16973894 | Mouse microRNA profiles determined with a new and sensitive cloning method. |
| 2 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |