| Accession | MI0003674 | ||||
| Name | hsa-mir-653 | ||||
| similar to following miRCarta precursors | hsa-368-833.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr7:93,482,760-93,482,855 (-) |
||||
| miRNA | hsa-miR-653-5p | ||||
| miRNA | hsa-miR-653-3p | ||||
| Sequence (5' -> 3') (96 nts) |
UUCAUUCCUUCAGUGUUGAAACAAUCUCUACUGAACCAGCUUCAAACAAGUUCACUGGAGUUUGUUUCAAUAUUGCAAGAAUGAUAAGAUGGAAGC | ||||
| MFE | -32.80 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-653 hsa-mir-489 |
||||
| Family | mir-653 (MIPF0000435) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Cummins et al. | Proc. Natl. Acad. Sci. U.S.A. | 2006 | 16505370 | The colorectal microRNAome. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |