| Accession | MI0003673 | ||||
| Name | hsa-mir-449b | ||||
| similar to following miRCarta precursors | hsa-923-1052.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr5:55,170,646-55,170,742 (-) |
||||
| miRNA | hsa-miR-449b-5p | ||||
| miRNA | hsa-miR-449b-3p | ||||
| Sequence (5' -> 3') (97 nts) |
UGACCUGAAUCAGGUAGGCAGUGUAUUGUUAGCUGGCUGCUUGGGUCAAGUCAGCAGCCACAACUACCCUGCCACUUGCUUCUGGAUAAAUUCUUCU | ||||
| MFE | -35.40 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-449a
hsa-mir-449b hsa-mir-449c |
||||
| Family | mir-449 (MIPF0000133) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Cummins et al. | Proc. Natl. Acad. Sci. U.S.A. | 2006 | 16505370 | The colorectal microRNAome. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Zhu et al. | J. Virol. | 2009 | 19144710 | Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas. |