Precursor miRBase

hsa-mir-574 (MI0003581)

Accession MI0003581
Name hsa-mir-574
similar to following miRCarta precursors hsa-213-149.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr4:38,868,032-38,868,127 (+)
miRNA hsa-miR-574-5p
miRNA hsa-miR-574-3p
Sequence (5' -> 3')
(96 nts)
GGGACCUGCGUGGGUGCGGGCGUGUGAGUGUGUGUGUGUGAGUGUGUGUCGCUCCGGGUCCACGCUCAUGCACACACCCACACGCCCACACUCAGG
MFE -57.00 kcal/mol
first miRBase version 8.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-574
Family mir-574 (MIPF0000419)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR574
NCBI Gene 693159

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Cummins et al. Proc. Natl. Acad. Sci. U.S.A. 2006 16505370 The colorectal microRNAome.
2 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.