Precursor miRBase

rno-mir-497 (MI0003724)

Accession MI0003724
Name rno-mir-497
similar to following miRCarta precursors rno-198-29586.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr10:56,589,141-56,589,209 (+)
miRNA rno-miR-497-5p
miRNA rno-miR-497-3p
Sequence (5' -> 3')
(69 nts)
CCAGCAGCACACUGUGGUUUGUACGGCACUGUGGCCACGUCCAAACCACACUGUGGUGUUAGAGCGAGG
MFE -28.10 kcal/mol
first miRBase version 8.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
rno-mir-497
rno-mir-195
Family mir-497 (MIPF0000231)
Experiments
experiment Pubmed link
SOLiD 20403161
External DBs
Gene symbol Mir497
NCBI Gene 100314259

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
2 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
3 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.