| Accession | MI0003724 | ||||
| Name | rno-mir-497 | ||||
| similar to following miRCarta precursors | rno-198-29586.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr10:56,589,141-56,589,209 (+) |
||||
| miRNA | rno-miR-497-5p | ||||
| miRNA | rno-miR-497-3p | ||||
| Sequence (5' -> 3') (69 nts) |
CCAGCAGCACACUGUGGUUUGUACGGCACUGUGGCCACGUCCAAACCACACUGUGGUGUUAGAGCGAGG | ||||
| MFE | -28.10 kcal/mol | ||||
| first miRBase version | 8.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
rno-mir-497 rno-mir-195 |
||||
| Family | mir-497 (MIPF0000231) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |