| Accession | MI0003721 | ||||
| Name | rno-mir-499 | ||||
| similar to following miRCarta precursors | rno-24371-28843.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr3:157,506,669-157,506,733 (+) |
||||
| miRNA | rno-miR-499-5p | ||||
| miRNA | rno-miR-499-3p | ||||
| Sequence (5' -> 3') (65 nts) |
GCUGUUAAGACUUGCAGUGAUGUUUAGCUCCUCUCCAUGUGAACAUCACAGCAAGUCUGUGCUGC | ||||
| MFE | -27.70 kcal/mol | ||||
| first miRBase version | 8.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
rno-mir-499 |
||||
| Family | mir-499 (MIPF0000173) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 2 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |