| Accession | MI0003718 | ||||
| Name | mmu-mir-302d | ||||
| similar to following miRCarta precursors | mmu-883-839.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr3:127,545,624-127,545,689 (+) |
||||
| miRNA | mmu-miR-302d-5p | ||||
| miRNA | mmu-miR-302d-3p | ||||
| Sequence (5' -> 3') (66 nts) |
CCUUUACUUUAACAUGGAGGCACUUGCUGUGCAUUUAAAAAUAAGUGCUUCCAUGUUUGAGUGUGG | ||||
| MFE | -27.50 kcal/mol | ||||
| first miRBase version | 8.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (5 precursors) |
mmu-mir-302b
mmu-mir-302c mmu-mir-302a mmu-mir-302d mmu-mir-367 |
||||
| Family | mir-302 (MIPF0000071) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |