Accession | MI0003555 | ||||
Name | rno-mir-503-1 | ||||
similar to following miRCarta precursors | rno-25654-29732.1 rno-25654-29732.2 | ||||
Organism | Rattus norvegicus | ||||
Genome | Rnor_5.0 | ||||
Location |
chrX:152,773,783-152,773,853 (+) |
||||
miRNA | rno-miR-503-5p | ||||
miRNA | rno-miR-503-3p | ||||
Sequence (5' -> 3') (71 nts) |
UGCCCUAGCAGCGGGAACAGUACUGCAGUGAGUGUUUGGUGCCCUGGAGUAUUGUUUCCGCUGCCUGGGUA | ||||
MFE | -41.70 kcal/mol | ||||
first miRBase version | 8.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
rno-mir-322-1
rno-mir-503-1 rno-mir-351-1 rno-mir-542-1 rno-mir-450b-1 rno-mir-450a |
||||
Family | mir-503 (MIPF0000183) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |