Accession | MI0003549 | ||||
Name | rno-mir-485 | ||||
similar to following miRCarta precursors | rno-730-29555.1 | ||||
Organism | Rattus norvegicus | ||||
Genome | Rnor_5.0 | ||||
Location |
chr6:143,047,656-143,047,734 (+) |
||||
miRNA | rno-miR-485-5p | ||||
miRNA | rno-miR-485-3p | ||||
Sequence (5' -> 3') (79 nts) |
GAUACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCUAAACGAGUCAUACACGGCUCUCCUCUCUUCUAGUGUC | ||||
MFE | -40.40 kcal/mol | ||||
first miRBase version | 8.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (21 precursors) |
rno-mir-381
rno-mir-487b rno-mir-3576 rno-mir-539 rno-mir-6331 rno-mir-544 rno-mir-3592 rno-mir-382 rno-mir-134 rno-mir-668 rno-mir-485 rno-mir-154 rno-mir-496 rno-mir-377 rno-mir-541 rno-mir-409b rno-mir-409a rno-mir-412 rno-mir-3578 rno-mir-369 rno-mir-410 |
||||
Family | mir-485 (MIPF0000201) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |