Accession | MI0003548 | ||||||||
Name | rno-mir-382 | ||||||||
similar to following miRCarta precursors | rno-274-513.1 | ||||||||
Organism | Rattus norvegicus | ||||||||
Genome | Rnor_5.0 | ||||||||
Location |
chr6:143,046,535-143,046,614 (+) |
||||||||
miRNA | rno-miR-382-5p | ||||||||
miRNA | rno-miR-382-3p | ||||||||
Sequence (5' -> 3') (80 nts) |
GGUACUUGAAGAGAAGUUGUUCGUGGUGGAUUCGCUUUACUUGUGACGAAUCAUUCACGGACAACACUUUUUUCAGUACC | ||||||||
MFE | -34.40 kcal/mol | ||||||||
first miRBase version | 8.0 | ||||||||
last miRBase version | 21.0 | ||||||||
Clusters (10 kb) (21 precursors) |
rno-mir-381
rno-mir-487b rno-mir-3576 rno-mir-539 rno-mir-6331 rno-mir-544 rno-mir-3592 rno-mir-382 rno-mir-134 rno-mir-668 rno-mir-485 rno-mir-154 rno-mir-496 rno-mir-377 rno-mir-541 rno-mir-409b rno-mir-409a rno-mir-412 rno-mir-3578 rno-mir-369 rno-mir-410 |
||||||||
Family | mir-154 (MIPF0000018) | ||||||||
Experiments |
|
||||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |