Precursor miRBase

mmu-mir-503 (MI0003538)

Accession MI0003538
Name mmu-mir-503
similar to following miRCarta precursors mmu-25654-25653.1
Organism Mus musculus
Genome GRCm38.p5
Location chrX:53,053,984-53,054,054 (-)
miRNA mmu-miR-503-5p
miRNA mmu-miR-503-3p
Sequence (5' -> 3')
(71 nts)
UGCCCUAGCAGCGGGAACAGUACUGCAGUGAGUGUUUGGUGCCCUGGAGUAUUGUUUCCACUGCCUGGGUA
MFE -36.30 kcal/mol
first miRBase version 8.0
last miRBase version 21.0
Clusters (10 kb)
(7 precursors)
mmu-mir-450b
mmu-mir-450a-1
mmu-mir-450a-2
mmu-mir-542
mmu-mir-351
mmu-mir-503
mmu-mir-322
Family mir-503 (MIPF0000183)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727
External DBs
Gene symbol Mir503
NCBI Gene 723879

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Sewer et al. BMC Bioinformatics 2005 16274478 Identification of clustered microRNAs using an ab initio prediction method.
2 Mineno et al. Nucleic Acids Res. 2006 16582102 The expression profile of microRNAs in mouse embryos.
3 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
4 Takada et al. Nucleic Acids Res. 2006 16973894 Mouse microRNA profiles determined with a new and sensitive cloning method.
5 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
6 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
7 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.