| Accession | MI0003533 | ||||||
| Name | mmu-mir-376c | ||||||
| similar to following miRCarta precursors | mmu-804-25232.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr12:109,722,718-109,722,803 (+) |
||||||
| miRNA | mmu-miR-376c-5p | ||||||
| miRNA | mmu-miR-376c-3p | ||||||
| Sequence (5' -> 3') (86 nts) |
UUUGGUAUUUAAAAGGUGGAUAUUCCUUCUAUGUUUAUGCUUUUUGUGAUUAAACAUAGAGGAAAUUUCACGUUUUCAGUGUCAAA | ||||||
| MFE | -28.10 kcal/mol | ||||||
| first miRBase version | 8.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (18 precursors) |
mmu-mir-758
mmu-mir-329 mmu-mir-494 mmu-mir-679 mmu-mir-1193 mmu-mir-666 mmu-mir-543 mmu-mir-495 mmu-mir-667 mmu-mir-376c mmu-mir-654 mmu-mir-376b mmu-mir-376a mmu-mir-300 mmu-mir-381 mmu-mir-487b mmu-mir-539 mmu-mir-544 |
||||||
| Family | mir-368 (MIPF0000091) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Kawahara et al. | Science | 2007 | 17322061 | Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |