Accession | MI0003528 | ||||||
Name | rno-mir-542-1 | ||||||
similar to following miRCarta precursors | rno-25650-136.1 rno-25650-136.2 rno-25650-136.3 | ||||||
Organism | Rattus norvegicus | ||||||
Genome | Rnor_5.0 | ||||||
Location |
chrX:152,777,453-152,777,531 (+) |
||||||
miRNA | rno-miR-542-5p | ||||||
miRNA | rno-miR-542-3p | ||||||
Sequence (5' -> 3') (79 nts) |
UCUCAGACGUCUCGGGGAUCAUCAUGUCACGAGAUACCACUGCGCACUUGUGACAGAUUGAUAACUGAAAGGUCUGGGA | ||||||
MFE | -33.20 kcal/mol | ||||||
first miRBase version | 8.0 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (7 precursors) |
rno-mir-322-1
rno-mir-503-1 rno-mir-351-1 rno-mir-542-1 rno-mir-450b-1 rno-mir-450a rno-mir-542-2 |
||||||
Family | mir-542 (MIPF0000185) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |