| Accession | MI0003523 | ||||
| Name | mmu-mir-547 | ||||
| similar to following miRCarta precursors | mmu-25696-25695.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chrX:67,988,374-67,988,451 (-) |
||||
| miRNA | mmu-miR-547-5p | ||||
| miRNA | mmu-miR-547-3p | ||||
| Sequence (5' -> 3') (78 nts) |
GUGUGAUGUAUCACUUGAGGAUGUACCACCCAUUUAACAGGAAACAUGCUUGGUACAUCUUUGAGUGAGAUAACACAC | ||||
| MFE | -33.30 kcal/mol | ||||
| first miRBase version | 8.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
mmu-mir-201
mmu-mir-547 |
||||
| Family | mir-547 (MIPF0000779) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |