| Accession | MI0003520 | ||||
| Name | mmu-mir-539 | ||||
| similar to following miRCarta precursors | mmu-25242-25241.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr12:109,728,129-109,728,202 (+) |
||||
| miRNA | mmu-miR-539-5p | ||||
| miRNA | mmu-miR-539-3p | ||||
| Sequence (5' -> 3') (74 nts) |
UACUUGAGGAGAAAUUAUCCUUGGUGUGUUGGCUCUUUUGGAUGAAUCAUACAAGGAUAAUUUCUUUUUGAGUA | ||||
| MFE | -30.20 kcal/mol | ||||
| first miRBase version | 8.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (16 precursors) |
mmu-mir-495
mmu-mir-667 mmu-mir-376c mmu-mir-654 mmu-mir-376b mmu-mir-376a mmu-mir-300 mmu-mir-381 mmu-mir-487b mmu-mir-539 mmu-mir-544 mmu-mir-382 mmu-mir-134 mmu-mir-668 mmu-mir-485 mmu-mir-453 |
||||
| Family | mir-154 (MIPF0000018) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Takada et al. | Nucleic Acids Res. | 2006 | 16973894 | Mouse microRNA profiles determined with a new and sensitive cloning method. |
| 3 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |