| Accession | MI0003529 | ||||
| Name | hsa-mir-376a-2 | ||||
| similar to following miRCarta precursors | hsa-986-469.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr14:101,040,069-101,040,148 (+) |
||||
| miRNA | hsa-miR-376a-2-5p | ||||
| miRNA | hsa-miR-376a-3p | ||||
| Sequence (5' -> 3') (80 nts) |
GGUAUUUAAAAGGUAGAUUUUCCUUCUAUGGUUACGUGUUUGAUGGUUAAUCAUAGAGGAAAAUCCACGUUUUCAGUAUC | ||||
| MFE | -29.00 kcal/mol | ||||
| first miRBase version | 8.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (16 precursors) |
hsa-mir-543
hsa-mir-495 hsa-mir-376c hsa-mir-376a-2 hsa-mir-654 hsa-mir-376b hsa-mir-376a-1 hsa-mir-300 hsa-mir-1185-1 hsa-mir-1185-2 hsa-mir-381 hsa-mir-487b hsa-mir-539 hsa-mir-889 hsa-mir-544a hsa-mir-655 |
||||
| Family | mir-368 (MIPF0000091) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Kawahara et al. | Science | 2007 | 17322061 | Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. |
| 4 | Voellenkle et al. | RNA | 2012 | 22282338 | Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs. |