| Accession | MI0002468 | ||||||
| Name | hsa-mir-484 | ||||||
| similar to following miRCarta precursors | hsa-127.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chr16:15,643,294-15,643,372 (+) |
||||||
| miRNA | hsa-miR-484 | ||||||
| Sequence (5' -> 3') (79 nts) |
AGCCUCGUCAGGCUCAGUCCCCUCCCGAUAAACCCCUAAAUAGGGACUUUCCCGGGGGGUGACCCUGGCUUUUUUGGCG | ||||||
| MFE | -32.50 kcal/mol | ||||||
| first miRBase version | 7.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-484 |
||||||
| Family | mir-484 (MIPF0000219) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Fu et al. | FEBS Lett. | 2005 | 15978578 | Identification of human fetal liver miRNAs by a novel method. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |