| Accession | MI0003196 | ||||
| Name | hsa-mir-509-1 | ||||
| similar to following miRCarta precursors | hsa-978-470.2 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:147,260,532-147,260,625 (-) |
||||
| miRNA | hsa-miR-509-5p | ||||
| miRNA | hsa-miR-509-3p | ||||
| Sequence (5' -> 3') (94 nts) |
CAUGCUGUGUGUGGUACCCUACUGCAGACAGUGGCAAUCAUGUAUAAUUAAAAAUGAUUGGUACGUCUGUGGGUAGAGUACUGCAUGACACAUG | ||||
| MFE | -41.00 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-509-2
hsa-mir-509-3 hsa-mir-509-1 |
||||
| Family | mir-506 (MIPF0000130) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 2 | Novotny et al. | Int. J. Androl. | 2007 | 17573847 | Analysis of gene expression in normal and neoplastic human testis: new roles of RNA. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |