| Accession | MI0003135 | ||||
| Name | hsa-mir-495 | ||||
| similar to following miRCarta precursors | hsa-1085-356.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr14:101,033,755-101,033,836 (+) |
||||
| miRNA | hsa-miR-495-5p | ||||
| miRNA | hsa-miR-495-3p | ||||
| Sequence (5' -> 3') (82 nts) |
UGGUACCUGAAAAGAAGUUGCCCAUGUUAUUUUCGCUUUAUAUGUGACGAAACAAACAUGGUGCACUUCUUUUUCGGUAUCA | ||||
| MFE | -35.30 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (18 precursors) |
hsa-mir-299
hsa-mir-380 hsa-mir-1197 hsa-mir-323a hsa-mir-758 hsa-mir-329-1 hsa-mir-329-2 hsa-mir-494 hsa-mir-1193 hsa-mir-543 hsa-mir-495 hsa-mir-376c hsa-mir-376a-2 hsa-mir-654 hsa-mir-376b hsa-mir-376a-1 hsa-mir-300 hsa-mir-1185-1 |
||||
| Family | mir-329 (MIPF0000110) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Voellenkle et al. | RNA | 2012 | 22282338 | Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs. |