| Accession | MI0003132 | ||||
| Name | hsa-mir-493 | ||||
| similar to following miRCarta precursors | hsa-344-376.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr14:100,869,060-100,869,148 (+) |
||||
| miRNA | hsa-miR-493-5p | ||||
| miRNA | hsa-miR-493-3p | ||||
| Sequence (5' -> 3') (89 nts) |
CUGGCCUCCAGGGCUUUGUACAUGGUAGGCUUUCAUUCAUUCGUUUGCACAUUCGGUGAAGGUCUACUGUGUGCCAGGCCCUGUGCCAG | ||||
| MFE | -47.90 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-493 hsa-mir-337 hsa-mir-665 |
||||
| Family | mir-493 (MIPF0000230) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |