Accession | MI0003069 |
Name | ppy-mir-25 |
similar to following miRCarta precursors | ppy-23.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
7:9,078,853-9,078,936 (-) |
miRNA | ppy-miR-25 |
Sequence (5' -> 3') (84 nts) |
GGCCAGUGUUGAGAGGCGGAGACUUGGGCAAUUGCUGGACGCUGCCCUGGGCAUUGCACUUGUCUCGGUCUGACAGUGCCGGCC |
MFE | -35.40 kcal/mol |
first miRBase version | 7.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (3 precursors) |
ppy-mir-25 ppy-mir-93 ppy-mir-106b |
Family | mir-25 (MIPF0000013) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |