Precursor miRBase

ppa-mir-106b (MI0003064)

Accession MI0003064
Name ppa-mir-106b
similar to following miRCarta precursors ppa-103.1
Organism Pan paniscus
miRNA ppa-miR-106b
Sequence (5' -> 3')
(82 nts)
CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCCGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG
MFE -43.20 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Family mir-17 (MIPF0000001)
External DBs
Gene symbol MIR106B
NCBI Gene 102466011

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.