Precursor miRBase

ggo-mir-194 (MI0003030)

Accession MI0003030
Name ggo-mir-194
similar to following miRCarta precursors ggo-131.1
Organism Gorilla gorilla
Genome GorGor3
Location 1:200,433,389-200,433,473 (-)
miRNA ggo-miR-194
Sequence (5' -> 3')
(85 nts)
AUGGUGUUAUCAAGUGUAACAGCAACUCCAUGUGGACUGUGUACCAAUUUCCAGUGGAGAUGCUGUUACUUUUGAUGGUUACCAA
MFE -38.40 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-194
Family mir-194 (MIPF0000055)
External DBs
Gene symbol MIR194
NCBI Gene 102466305

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.