Accession | MI0002996 | ||||
Name | ptr-mir-18a | ||||
similar to following miRCarta precursors | ptr-262.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
13:91,522,892-91,522,962 (+) |
||||
miRNA | ptr-miR-18a | ||||
Sequence (5' -> 3') (71 nts) |
UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCA | ||||
MFE | -20.90 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
ptr-mir-17
ptr-mir-18a ptr-mir-19a ptr-mir-20a ptr-mir-19b-1 ptr-mir-92-1 |
||||
Family | mir-17 (MIPF0000001) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |