| Accession | MI0002959 |
| Name | ppy-mir-15a |
| similar to following miRCarta precursors | ppy-116.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
13:50,305,217-50,305,299 (-) |
| miRNA | ppy-miR-15a |
| Sequence (5' -> 3') (83 nts) |
CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG |
| MFE | -29.90 kcal/mol |
| first miRBase version | 7.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-16-1
ppy-mir-15a |
| Family | mir-15 (MIPF0000006) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |