| Accession | MI0002958 | ||||
| Name | mml-mir-16-1 | ||||
| similar to following miRCarta precursors | mml-62-415.1 | ||||
| Organism | Macaca mulatta | ||||
| miRNA | mml-miR-16-5p | ||||
| miRNA | mml-miR-16-1-3p | ||||
| Sequence (5' -> 3') (89 nts) |
GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC | ||||
| MFE | -36.50 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-15 (MIPF0000006) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
| 2 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |