Accession | MI0002936 |
Name | ppy-mir-181b |
similar to following miRCarta precursors | ppy-73.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
1:51,520,745-51,520,854 (+) |
miRNA | ppy-miR-181b |
Sequence (5' -> 3') (110 nts) |
CCUGUGCAGAGAUUAUUGUUUAAAAGGUCACAAUCAACAUUCAUUGCUGUCGGUGGGUUGAACUGUGUGGACAAGCUCACUGAACAAUGAAUGCAACUGUGGCCCCGCUU |
MFE | -33.20 kcal/mol |
first miRBase version | 7.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
ppy-mir-181a-1
ppy-mir-181b |
Family | mir-181 (MIPF0000007) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |