Precursor miRBase

ppy-mir-197 (MI0002910)

Accession MI0002910
Name ppy-mir-197
similar to following miRCarta precursors ppy-99.1
Organism Pongo abelii
Genome PPYG2
Location 1:118,669,818-118,669,892 (-)
miRNA ppy-miR-197
Sequence (5' -> 3')
(75 nts)
GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCUCCACCCAGCAUGGCC
MFE -41.40 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ppy-mir-197
Family mir-197 (MIPF0000123)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.