Precursor miRBase

ptr-mir-197 (MI0002909)

Accession MI0002909
Name ptr-mir-197
similar to following miRCarta precursors ptr-99.1
Organism Pan troglodytes
Genome CHIMP2.1.4
Location 1:110,356,884-110,356,958 (+)
miRNA ptr-miR-197
Sequence (5' -> 3')
(75 nts)
GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCUCCACCCAGCAUGGCC
MFE -41.40 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ptr-mir-197
Family mir-197 (MIPF0000123)
External DBs
Gene symbol MIR197
NCBI Gene 751925

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.