Precursor miRBase

ggo-mir-218 (MI0002868)

Accession MI0002868
Name ggo-mir-218
similar to following miRCarta precursors ggo-185.1
Organism Gorilla gorilla
Genome GorGor3
Location 4:20,566,708-20,566,817 (+)
miRNA ggo-miR-218
Sequence (5' -> 3')
(110 nts)
GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA
MFE -40.00 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-218
Family mir-218 (MIPF0000026)
External DBs
Gene symbol MIR218
NCBI Gene 102464173

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.