Accession | MI0002734 |
Name | ppy-mir-29b-2 |
similar to following miRCarta precursors | ppy-81.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
1:42,327,544-42,327,624 (+) |
miRNA | ppy-miR-29b |
Sequence (5' -> 3') (81 nts) |
CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG |
MFE | -31.10 kcal/mol |
first miRBase version | 7.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
ppy-mir-29b-2 ppy-mir-29c |
Family | mir-29 (MIPF0000009) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |