| Accession | MI0002714 | ||||
| Name | mml-mir-100 | ||||
| similar to following miRCarta precursors | mml-27-28266.1 | ||||
| Organism | Macaca mulatta | ||||
| Genome | CR_1.0 | ||||
| Location |
chr14:123,116,508-123,116,587 (-) |
||||
| miRNA | mml-miR-100-5p | ||||
| miRNA | mml-miR-100-3p | ||||
| Sequence (5' -> 3') (80 nts) |
CCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAUUAGUCCGCACAAGCUUGUGUCUAUAGGUAUGUGUCUUUUAGG | ||||
| MFE | -26.00 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
mml-let-7a-2
mml-mir-100 |
||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
| 2 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |